Data

We firstly need to reverse the string which we can do by list slicing. We then loop through the now inversed string changing A to T, C to G, etc.

We can write a function to easily get the count of the letters of a string. We use a Python dictionary to store and count the DNA string nucleotides:

Notes, code, and solutions for ISLR: Chapter 2 Chapter 3 Chapter 4

Notes, code, and solutions for Linear Algebra: Theory, Intuition, Code by Mike X Cohen: Chapter 2 Chapter 3 Chapter 4

Solutions to Project Rosalind questions: Counting DNA Nucleotides Transcribing DNA into RNA Complementing a Strand of DNA

This is an extremely easy problem. We can just use the replace string method to replace the T’s with U’s: def dna_transtribed_to_rna(dna_string: str) -> str: """ Parameters ---------- dna_string : Str DNA Nucleotide String (DNA String) Returns ------- String Transcribes the DNA string into a RNA string (replaces Thymine with Uracil) Example ------- Input: GATGGAACTTGACTACGTAAATT Output: GAUGGAACUUGACUACGUAAAUU """ return dna_string.